|
VectorBuilder GmbH
plv[shdux4]-hygro-u6 (cgagtggctttgccctcccga) Plv[Shdux4] Hygro U6 (Cgagtggctttgccctcccga), supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plvx+hygro/pm31693889-495-221-224?v=VectorBuilder+GmbH Average 90 stars, based on 1 article reviews
plv[shdux4]-hygro-u6 (cgagtggctttgccctcccga) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
VectorBuilder GmbH
plv[shrna]-hygro-u6>mldha [shrna#1] Plv[Shrna] Hygro U6>Mldha [Shrna#1], supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plvx+hygro/pmc12047472-133-0-3?v=VectorBuilder+GmbH Average 90 stars, based on 1 article reviews
plv[shrna]-hygro-u6>mldha [shrna#1] - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
VectorBuilder GmbH
lentivirus plv[exp]-egfp:t2a: hygro-hpgk>{grn4+linker Lentivirus Plv[Exp] Egfp:T2a: Hygro Hpgk>{Grn4+Linker, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plvx+hygro/pmc11773623-39-0-4?v=VectorBuilder+GmbH Average 90 stars, based on 1 article reviews
lentivirus plv[exp]-egfp:t2a: hygro-hpgk>{grn4+linker - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Addgene inc
pip fucci plasmid Pip Fucci Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plvx+hygro/pm38823395-1050-13-15?v=Addgene+inc Average 94 stars, based on 1 article reviews
pip fucci plasmid - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
Addgene inc
plvx hygro Plvx Hygro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plvx+hygro/pm41086206-289-8-15?v=Addgene+inc Average 93 stars, based on 1 article reviews
plvx hygro - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
VectorBuilder GmbH
lentivirus plv[exp]cbh>dcas9-krab-mecp2:t2a:hygro Lentivirus Plv[Exp]Cbh>Dcas9 Krab Mecp2:T2a:Hygro, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plvx+hygro/pm37352861-82-20-22?v=VectorBuilder+GmbH Average 90 stars, based on 1 article reviews
lentivirus plv[exp]cbh>dcas9-krab-mecp2:t2a:hygro - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
VectorBuilder GmbH
plasmid plv[exp]-cmv>tts/rtta/hygro Plasmid Plv[Exp] Cmv>Tts/Rtta/Hygro, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plvx+hygro/pm37142218-103-12-25?v=VectorBuilder+GmbH Average 90 stars, based on 1 article reviews
plasmid plv[exp]-cmv>tts/rtta/hygro - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Addgene inc
plv htert ires hygro Plv Htert Ires Hygro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plvx+hygro/pmc11005365-265-12-18?v=Addgene+inc Average 94 stars, based on 1 article reviews
plv htert ires hygro - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
OriGene
plv nop10 ires hygro nop10 expression plasmid ![]() Plv Nop10 Ires Hygro Nop10 Expression Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plvx+hygro/pm34638246-185-1-9?v=OriGene Average 90 stars, based on 1 article reviews
plv nop10 ires hygro nop10 expression plasmid - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Promega
plvx-hygro plasmid carrying luc2 firefly luciferase gene ![]() Plvx Hygro Plasmid Carrying Luc2 Firefly Luciferase Gene, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plvx+hygro/pmc05223529-104-12-19?v=Promega Average 90 stars, based on 1 article reviews
plvx-hygro plasmid carrying luc2 firefly luciferase gene - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
VectorBuilder GmbH
plv[exp]-cmv>tet3g /hygro ![]() Plv[Exp] Cmv>Tet3g /Hygro, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plvx+hygro/pm33461384-206-23-27?v=VectorBuilder+GmbH Average 90 stars, based on 1 article reviews
plv[exp]-cmv>tet3g /hygro - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
VectorBuilder GmbH
plv[mir30]-hygro-tre>orf_stuffer: {mslc16a3[mir30-shrna#1] ![]() Plv[Mir30] Hygro Tre>Orf Stuffer: {Mslc16a3[Mir30 Shrna#1], supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plvx+hygro/pmc12047472-138-0-3?v=VectorBuilder+GmbH Average 90 stars, based on 1 article reviews
plv[mir30]-hygro-tre>orf_stuffer: {mslc16a3[mir30-shrna#1] - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cancers
Article Title: Analysis of Telomere Maintenance Related Genes Reveals NOP10 as a New Metastatic-Risk Marker in Pheochromocytoma/Paraganglioma.
doi: 10.3390/cancers13194758
Figure Lengend Snippet: Figure 2. Summary of genomic alterations in PPGL series linked to telomerome events. Tumor behavior and patient follow-up are shown, non-metastatic patients mean follow-up = 7.67 years (min: 9 days, max: 36 years). Patients classification was made according to driver mutations. Events in ATRX include ATRX low expression and ATRX loss of function mutations. TERT events include: TERT overexpression, TERT promoter mutation, TERT promoter hypermethylation (UTSS median value > 16.1%) and CN gain 5p. NOP10 and FBXO4 expression outliers and continuous expression data are shown.
Article Snippet: 2.
Techniques: Expressing, Over Expression, Mutagenesis
Journal: Cancers
Article Title: Analysis of Telomere Maintenance Related Genes Reveals NOP10 as a New Metastatic-Risk Marker in Pheochromocytoma/Paraganglioma.
doi: 10.3390/cancers13194758
Figure Lengend Snippet: Figure 4. (A) Receiver operating characteristic curve (ROC) analysis showing the accuracy of telomerome events to distinguish between metastatic and non-metastatic samples. This data corresponds to all metastatic (n = 54) and non- metastatic cases with ≥8 years of follow-up (n = 45). Metastases (n = 9), clinically aggressive samples (n = 5) and non-metastatic cases with <8 years’ follow-up (n = 52) were excluded. Genes were introduced as a dichotomous variable based on outlier expressors. TERT events: overexpression, promoter mutation, promoter hypermethylation or gains; ATRX events: low expression outliers and mutations; NOP10 events: overexpression outliers. Any event in TERT+ATRX: p-value: 2.46 × E−6, AUC: 0.767; 95%CI: 0.678–0.856; any event in TERT+ATRX+NOP10: p-value: 1.35 × E−7, AUC: 0.798; 95%CI: 0.714–0.882; any event in NOP10: p-value: 0.439, AUC: 0.548; 95%CI: 0.439–0.656. (B) Kaplan–Meier plots of time to progression of patients, according to the events in TERT/ATRX (left) and to the events in the three telomerome significant genes (TERT/ATRX/NOP10) (right). n = number of samples. Log-rank test p-value is shown. Non-metastatic patients with unknown follow-up and those with clinically aggressive tumors were excluded from the analysis.
Article Snippet: 2.
Techniques: Over Expression, Mutagenesis, Expressing
Journal: Cancers
Article Title: Analysis of Telomere Maintenance Related Genes Reveals NOP10 as a New Metastatic-Risk Marker in Pheochromocytoma/Paraganglioma.
doi: 10.3390/cancers13194758
Figure Lengend Snippet: Figure 6. In vitro telomere length analysis. (A) Cell proliferation per condition. X axis: number of days in culture since antibiotic selection; Y axis: accumulative number of passages. Parental and NOP10 become quiescent after 3 passages. TERT cells become quiescent after 8 passages and TERT+NOP10 after 10 passages. (B) Scatter dot plot showing telomere length. Percentages of short and long telomeres for each isogenic primary culture are shown. Graph separations were made according to percentile 10 and 90 (P10 and P90) based on “Parental p0”. Median telomere length value graphed in black. (C) Median telomere length value per cell (one-way ANOVA Tukey’s multiple comparison test: **: p-value < 0.01; ***: p-value < 0.001).
Article Snippet: 2.
Techniques: In Vitro, Selection, Comparison
Journal: Journal of Experimental & Clinical Cancer Research : CR
Article Title: Motility of glioblastoma cells is driven by netrin-1 induced gain of stemness
doi: 10.1186/s13046-016-0482-0
Figure Lengend Snippet: Netrin-1 promotes glioblastoma growth in vivo. a–d U87MG or ( e–i ) U373MG cells expressing firefly luciferase and full-length NTN1 (NTN1FH) or its central domain (NTN1(II)FH) were intracranial implanted into nude mice. Five mice per cell-line was xenografted. a, e and f The growth of the tumors was followed with bioluminescent imaging. Photons emitted by the tumor were recorded and quantitated. The photons emitted by the U373MG xenografts were quantitated separately from the head area of the mice ( e ) and together from the head and spine ( f ). Growth curves represent the average photons/second emitted by the tumors in each group. Error bars represent the standard error of the mean. * p value is <0,05. b-d and f-h Representative image of mice in each xenograft group at the experiment end point are presented. The color bars indicate the intensity of photons emitted by the tumor. The color bar scales are set on equal levels within the groups of U87MG xenografts ( b-d ) and within the groups of U373MG xenografts ( f-h )
Article Snippet: For intracranial xenograft experiments U87MG and U373MG cells were transduced with a
Techniques: In Vivo, Expressing, Luciferase, Imaging